Article
A new mouse model to study restoration of interleukin-6 (IL-6) expression in a Cre-dependent manner: microglial IL-6 regulation of experimental autoimmune encephalomyelitis | Journal of Neuroinflammation | Full Text
Specific primers for IL-6 regions | Download Scientific Diagram
Frontiers | Production of IL-6 and Phagocytosis Are the Most Resilient Immune Functions in Metabolically Compromised Human Monocytes
Sequence of the Oligonucleotide Primers Used in Real-Time PCR for IL-6,... | Download Table
xmlinkhub
Table 1 from PROVO, JAMES NATHAN, M.S. Impact of Trans-10, cis-12 Conjugated Linoleic Acid on Interleukin (IL)-6 and IL-8 and Adipogenic Genes in Cultures of Human Adipose | Semantic Scholar
Frontiers | Increased Expression of Interleukin-6 Family Members and Receptors in Urinary Bladder with Cyclophosphamide-Induced Bladder Inflammation in Female Rats
Frontiers | IL-10/STAT3/SOCS3 Axis Is Involved in the Anti-inflammatory Effect of Benznidazole
Chromatin remodelling and autocrine TNFα are required for optimal interleukin-6 expression in activated human neutrophils | Nature Communications
Primers, Probes and Amplicon Size of TNF-a, IL-10, and IL-6 | Download Scientific Diagram
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Primers used for TNF-a, IL-1b, IL-6 and GAPDH. | Download Table
Interleukin-6 expression by interactions between gynecologic cancer cells and human mesenchymal stem cells promotes epithelial-mesenchymal transition
A Newly Designed Curcumin Analog Y20 Mitigates Cardiac Injury via Anti-Inflammatory and Anti-Oxidant Actions in Obese Rats | PLOS ONE
The RT-PCR primers of interested genes. | Download Table
Primers for ARMS-PCR and sequencing analysis of IL-6 and TNF-α genes. | Download Table
Enhanced IL-6/IL-6R Signaling Promotes Growth and Malignant Properties in EBV-Infected Premalignant and Cancerous Nasopharyngeal Epithelial Cells | PLOS ONE
Sequences of PCR primers for feline GAPDH, Blimp-1, IL-6, CD40L, BAFF... | Download Table
Primer and probe sequences. | Download Table
Primer sequences of the reference gene (GAPDH) and pro-inflammatory... | Download Table
Frontiers | TIMP3 Overexpression Improves the Sensitivity of Osteosarcoma to Cisplatin by Reducing IL-6 Production
Particulate matter induces inflammatory cytokine production via activation of NFκB by TLR5-NOX4-ROS signaling in human skin keratinocyte and mouse skin - ScienceDirect
Dihydrocapsaicin Attenuates Plaque Formation through a PPARγ/LXRα Pathway in apoE−/− Mice Fed a High-Fat/High-Cholesterol Diet | PLOS ONE
PCR primer description and sequences | Download Table
Primer sequences for qPCR analysis of IL-6, IL-8, IL-1β, and TNF-α gene... | Download Scientific Diagram
